Orientation in the Gene “Letter Jungle”
 |
However, only a fraction of these three billion letters, namely two percent, contains the blueprints for all the materials that an organism needs to live. Large areas of DNA have no recognisable function.
To trace these blueprints or genes in this tremendous jumble, scientists from the German Research Center for Biotechnology (GBF) in Brunswick have developed a gene search engine. It is called NGFN-BLAST and is available to all scientists via the Internet. NGFN stands for the German National Genome Research Network and BLAST for Basic Local Alignment Search Tool. The name indicates another significant feature of the search tool: it allows comparison of the genetic data of different organisms with each other, for example that of the rat, the mouse and human beings.
AAAACCTTAAGAAATATTTT – these letters at first mean nothing even to a genome researcher. If the search engine user enters this letter sequence under ngfnblast.gbf.de, NGFNBLAST will search the gene databases of e.g. humans, the mouse and the rat. The user is allowed to select the gene databases that are to be searched, thus saving search and analysis time. In this case, the result for the query sequence would be that it is a part of the gamma interferon gene. This gene contains the blueprint for a protein, with which our immune system can combat bacteria and viruses. Furthermore, the result displays which letters in the blueprint for this protein differ for humans, the mouse and the rat.
"Due to the high workload of the twomain search engines used in Great Britain and the US, there are often long waits for results. The new search engine NGFN-Blast speeds up the search fo genes
Gene search engine NGFN-BLAST 
